bcl2fastq2 Conversion Software v2.20
Software Guide
Introduction 3
Requirements and Installation 4
Input Files 5
Convert and Demultiplex BCLFiles 12
Output Files and Directory 16
Troubleshooting 24
Revision History 25
Technical Assistance 26
Document # 15051736 v03
February 2019
ILLUMINA PROPRIETARY
For Research Use Only. Not for use in diagnostic procedures.
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for
the contractual use of its customer in connection with the use of the product(s) described herein and for no other
purpose. This document and its contents shall not be used or distributed for any other purpose and/or otherwise
communicated, disclosed, or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina
does not convey any license under its patent, trademark, copyright, or common-law rights nor similar rights of any third
parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in
order to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be
fully read and understood prior to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY
RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE
TO OTHER PROPERTY, AND WILL VOID ANY WARRANTY APPLICABLE TO THE PRODUCT(S).
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)
DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).
© 2019 Illumina, Inc. All rights reserved.
All trademarks are the property of Illumina, Inc. or their respective owners. For specific trademark information, see
www.illumina.com/company/legal.html.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
2
bcl2fastq2 Conversion Software v2.20 Software Guide
Introduction
The Illumina bcl2fastq2 Conversion Software v2.20 demultiplexes sequencing data and converts base call
(BCL)files into FASTQ files. For every cycle of a sequencing run, the Real-Time Analysis (RTA)software
generates a BCLfile containing base calls and associated quality scores (Q-scores). Most data analysis
applications require FASTQ files as input.
Local Run Manager and MiSeq Reporter automatically convert BCLfiles into FASTQ files as a first step in an
analysis. When a run is streamed to BaseSpace Sequence Hub for analysis, BaseSpace Sequence Hub also
automatically convertsBCLfiles. The resulting FASTQ files are then used as input for the analysis app.
For other data analysis applications, use the bcl2fastq2 Conversion Software to convert BCLfiles from any
Illumina sequencing system running RTA v1.18.54, or later. For earlier versions of RTA, use bcl2fastq v1.8.4.
BCLto FASTQConversion Process
The software uses input files, which are the output of a sequencing run, to convert BCLfiles into FASTQfiles.
For each cluster that passes filter (PF), the software writes one entry to one FASTQ file for each sample in
each read.
u For a single-read run, the software creates one Read 1 FASTQ file per sample.
u For a paired-end run, the software creates one Read 1 and one Read 2 FASTQ file per sample.
The sample FASTQ files are compressed and appended with the *fastq.gz extension. Thus, per-cycle
BCLfiles are converted into per-read FASTQfiles that can be used as input for data analysis.
Demultiplexing Process
Multiplexing adds a unique index adapter sequence to each sample during library prep, generating uniquely
tagged libraries that can be identified and sorted for analysis. Demultiplexing then assigns clusters to a
sample based on the index adapter sequence of the cluster.
NOTE
To optimize demultiplexing results, choose index adapters that optimize color balance when performing
library prep. For more information, see the
Index Adapters Pooling Guide (document # 1000000041074)
.
The bcl2fastq2 Conversion Software demultiplexes multiplexed samples as part of the conversion process. If
samples are not multiplexed, the software skips demultiplexing and assigns all clusters in a flow cell lane to
one sample.
Adapter Trimming and UMIRemoval
Depending on settings, the bcl2fastq2 Conversion Software trims adapter sequences and removes Unique
Molecular Identifier (UMI)bases from reads:
u Adapter trimming—The software determines whether a read extends past the DNA insert and into the
sequencing adapter. An approximate string matching algorithm identifies all or part of the adapter
sequence and treats inserts and deletions (indels) as one mismatch. Base calls matching the adapter
sequence and beyond are masked or removed from the FASTQ file.
u UMI removal—UMIs are random k-mers attached to the genomic DNA(gDNA) before polymerase chain
reaction (PCR)amplification. After the UMI is amplified with amplicons, the software can retrieve the
bases and include them in the read name in the FASTQfiles. When the TrimUMI sample sheet setting is
active, the software can also remove the bases from the reads.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
3
bcl2fastq2 Conversion Software v2.20 Software Guide
Requirements and Installation
Download the bcl2fastq2 Conversion Software v2.20 from the bcl2fastq Conversion Software support pages
on the Illumina website, and then install it on a computer that meets the following requirements.
Component Requirements
Network infrastructure
1 Gb minimum
Server infrastructure
Single multiprocessor or multicore computer running Linux
Memory
32 GB RAM
Operating system
Red Hat Enterprise Linux 6 or CentOS 6*
Software
The following software is always required:
• zlib
• librt
• libpthread
Installing from source requires the following additional software:
• gcc 4.8.2 or later (with support for C++11)
• boost 1.54
• CMake 2.8.9
* OtherLinux distributions might function but are not supported.
The bcl2fastq2 Conversion Software has a command-line interface. Installation requires assistance from an
ITrepresentative or system administrator with the appropriate privileges. You can install from an
RPMpackage (recommended)or from source (advanced).
Install From RPMPackage
Installing from the RPMpackage is the typical, recommended installation option. The starting point is the
binary executable /usr/local/bin/bcl2fastq.
1 Make sure that you have access to the root system.
2 Install the RPMpackage using one of the following commands:
u To install the software in the default location, enter:
yum install -y <rpm package-name>
u To specify a custom install location, enter:
rpm --install --prefix <user-specified directory>
<rpm package-name>
Install From Source
Installing from source is intended for advanced users who are not using the recommended operating
systems.
Directory Locations
The following environment variables specify directory locations for installation. The build directory and source
directory must be different.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
4
bcl2fastq2 Conversion Software v2.20 Software Guide
Variables Description
SOURCE
Location of the bcl2fastq2 Conversion Software source code.
BUILD
Location of the build directory.
INSTALL_DIR
Location where the executable is installed.
For example, you can set the environment variables as:
export TMP=/tmp
export SOURCE=${TMP}/bcl2fastq
export BUILD=${TMP}/bcl2fastq2-v2.19.x-build
export INSTALL_DIR=/usr/local/bcl2fastq2-v2.19.x
Build and Install the Software
1 Make sure that you have access to the ${INSTALL_DIR} directory:
u In step 3, the directory requires write permission.
u In step 4, the directory might require root privilege.
2 Decompress and extract the source code using the following command, which populates the directory
${TMP}/bcl2fastq:
cd ${TMP}
tar -xvzf bcl2fastq2-v2.19.x.tar.gz
3 Configure the build using the following commands, which create and populate the build directory:
mkdir ${BUILD}
cd ${BUILD}
chmod ugo+x ${SOURCE}/src/configure
chmod ugo+x ${SOURCE}/src/cmake/bootstrap/installCmake.sh
${SOURCE}/src/configure --prefix=${INSTALL_DIR}
In the final command, --prefix provides the absolute path to the installation directory.
4 Build and install the package using the following commands:
cd ${BUILD}
make
make install
Input Files
For each run, the control software generates an output folder to hold the BCLfiles and other sequencing
data. The bcl2fastq2 Conversion Software uses this output as input. The output is recorded in various file
formats, which are described in the following sections. If a sample sheet is uploaded to the control software
during run setup, it is included among the output.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
5
bcl2fastq2 Conversion Software v2.20 Software Guide
NOTE
This guide uses the terms output folder and run folder interchangeably. The output folder is a copy of the run
folder, so either folder is acceptable input for bcl2fastq2 Conversion Software. When configuring the
instrument or setting up a run, you have the option of setting the output folder location. The run folder
location is system-defined.
If your instrument is configured to save the output folder locally on the control computer, you must transfer the
folder to the computer with bcl2fastq2 Conversion Software installed. Otherwise, you can access the output
folder from a network location.
Sequencing Data
The following table lists the output files that comprise sequencing data. The bcl2fastq2 Conversion Software
uses these output files as input.
System Input for bcl2fastq2 Conversion Software
HiSeq X, HiSeq 4000, and HiSeq 3000 • Base call files (*.bcl.gz)
• Filterfiles (*.filter)
• Cluster location files (s.locs)
• RunInfo.xml
• [Optional] Sample sheet (*.csv)
iSeq 100 • Base call files (*.bcl.bgzf)
• Filter files (*.filter)
• Cluster location files (s.locs)
• RunInfo.xml
• [Optional] Sample sheet (*.csv)
MiniSeq, NextSeq 550, and NextSeq 500 • Base call files (*bcl.bgzf)
• Base call index files (*.bci)
• Filterfiles (*.filter)
• Cluster location files (*.locs)
• RunInfo.xml
• [Optional] Sample sheet (*.csv)
MiSeq, HiSeq 2500, and HiSeq 2000 • Base call files (*.bcl.gz)
• Statistics files (*.stats)
• Filter files (*.filter)
• Cluster location files (*.locs)
• RunInfo.xml
• Configuration files
• [Optional] Sample sheet (*.csv)
NovaSeq 6000 • Concatenated base call files (*.cbcl)
• Filterfiles (*.filter)
• Cluster location files (s.locs)
• RunInfo.xml
• [Optional] Sample sheet (*.csv)
All output files reside in the output folder. The output folder naming convention varies by system and can
include the following variables separated by underscores:
u The six- or eight-digit date of the run in YYMMDD or YYYYMMDD format.
u The instrument or control computer ID consisting of any combination of alphanumeric characters and
hyphens.
u A consecutively numbered experiment or run ID consisting of at least one digit.
u The flow cell ID.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
6
bcl2fastq2 Conversion Software v2.20 Software Guide
For example, the iSeq 100 System uses the naming format <YYYYMMDD>_<Instrument ID>_<Run
Number>_<Flow Cell ID>, resulting in an output folder named 20180331_FFSP247_4_BNS417-05-25-12. For
more information on output folder directories and names, base calling, and tiles, see the system guide for
your instrument.
As a best practice, give experiments and samples unique names to prevent naming conflicts. When
publishing data to a public database, use a prefix for each instrument with the identity of the lab.
Base Call Files
Base call (BCL) files are compressed with the gzip (*.gz) or blocked GNU zip (*.bgzf) format.
Bytes Description Data Type
Bytes 0–3 Number of N cluster Unsigned 32 bits integer
Bytes 4–(N+3)
N–Cluster index
Bits 0–1 are the bases, [A, C, G, T] for [0, 1, 2, 3].
Bits 2–7 are shifted by 2 bits and contain the quality score.
All bits with 0 in a byte are reserved for no call.
Unsigned 8 bits integer
Table 1 BCL File Format
Concatenated Base Call Files
Concatenated base call (CBCL) files contain aggregated BCLdata. Tiles from the same lane and surface are
aggregated into one CBCLfile for each lane and surface.
CBCLFile Header
Bytes/Field Description Data Type
Bytes 0–1 Version number, current version is 1 unsigned 16 bits little endian integer
Bytes 2–5 Header size unsigned 32 bits little endian integer
Byte 6 Number of bits per base call unsigned
Byte 7 Number of bits per q-score unsigned
q-val mapping info
Bytes 0–3 Number of bins (B), zero indicates no
mapping
B pairs of 4 byte values (if B > 0) {from, to}, {from, to}, {from, to} …
from: quality score bin
to: quality score
Number of tile records unsigned 32 bits little endian integer
gzip virtual file offsets, one record per tile
Bytes 0–3: tile number
Bytes 4–7 Number of clusters written into the
current block (required due to bit-
packed q-scores)
unsigned 32 bit integer
Bytes 8–11 Uncompressed block size of the tile
data (useful for sanity check when
excluding non-PF clusters)
unsigned 32 bit integer
Bytes 12–15 Compressed block size of the tile
data
unsigned 32 bit integer
non-PF clusters excluded flag 1: non-PF clusters are excluded
0: non-PF clusters are included
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
7
bcl2fastq2 Conversion Software v2.20 Software Guide
CBCL File Content
N blocks of gzip files, where N is the number of tiles. Each block consists of C number of base calls and quality score
pairs where C is the number of clusters for the given tile.
Each base call and quality score pair has the following format (assuming base calls use 2 bits):
• Bits 0–1: Base calls (respectively [A, C, G, T] for [00, 01, 10, 11])
• Bits 2 and up: Quality score (unsigned Q bit little endian integer where Q is the number of bits per q-score).
For a 2-bit quality score, each byte has two clusters where the bottom 4 bits are the first cluster and the higher 4 bits are
the second cluster.
Base Call Index Files
Base call index files (BCI) files contain one record per tile in binary format.
Bytes Description
Bytes 0–3 The tile number.
Bytes 4–7 The number of clusters in the tile.
Statistics Files
Statistics (STATS) files are binary files that contain base calling statistics.
Start Description Data Type
Byte 0 Cycle number. integer
Byte 4 Average cycle intensity. double
Byte 12 Average intensity for A for all clusters with intensity for A. double
Byte 20 Average intensity for C for all clusters with intensity for C. double
Byte 28 Average intensity for G for all clusters with intensity for G. double
Byte 36 Average intensity for T for all clusters with intensity for T. double
Byte 44 Average intensity for A for clusters with base call A. double
Byte 52 Average intensity for C for clusters with base call C. double
Byte 60 Average intensity for G for clusters with base call G. double
Byte 68 Average intensity for T for clusters with base call T. double
Byte 76 Number of clusters with base call A. integer
Byte 80 Number of clusters with base call C. integer
Byte 84 Number of clusters with base call G. integer
Byte 88 Number of clusters with base call T. integer
Byte 92 Number of clusters with base call X.* integer
Byte 96 Number of clusters with intensity for A . integer
Byte 100 Number of clusters with intensity for C. integer
Byte 104 Number of clusters with intensity for G. integer
Byte 108 Number of clusters with intensity for T. integer
Table 2 STATS File Format
* X indicates an unknown base.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
8
bcl2fastq2 Conversion Software v2.20 Software Guide
Filter Files
Filter files are binary files that specify whether clusters passed filter.
Bytes Description
Bytes 0–3 Zero value (for backwards compatibility).
Bytes 4–7 The filter format version number.
Bytes 8–11 The number of clusters.
Bytes 12–(N+11)
N—cluster number
Unsigned 8 bits integer. Bit 0 is pass or failed filter.
Table 3 Filter File Format
Configuration Files
One configuration file resides in the Intensities folder and records information on the generation of subfolders
in the output folder directory. It contains a tag-value list describing the cycle-image folders used to generate
each folder of intensity and sequence files.
The other configuration file resides in the BaseCalls folder and contains metadata on the sequencing run.
Both files are in XMLformat.
Location Files
Location files (LOCS) are binary files that contain the cluster positions on the flow cell. CLOCS files are
compressed versions of LOCSfiles.
Files appended with _pos.txt are text-based files containing two columns and a number of rows equal to the
number of clusters. The first column records the X-coordinate and the second column records the Y-
coordinate. Each row ends with <cr><lf>.
Run Information File
The run information file (RunInfo.xml) resides at the root level of the output folder. The file contains the run
name, number of cycles, whether a read is an Index Read, and the number of swaths and tiles.
Sample Sheets
A sample sheet (SampleSheet.csv) records information about samples and the corresponding index
adapters. The bcl2fastq2 Conversion Software uses this information to demultiplex and convert BCLfiles.
For most runs, a sample sheet is optional. The default location is the root output folder, but you can use the
command --sample-sheet to specify any CSV file in any location. When a sample sheet is not provided, the
software assigns all reads to the default sample Undertermined_S0.
Settings Section
The software uses the Settings section of the sample sheet to specify adapter trimming, cycle, UMI, and
index options.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
9
bcl2fastq2 Conversion Software v2.20 Software Guide
Setting Description
Adapter or TrimAdapter The sequence of the adapter to be trimmed. If a sequence for AdapterRead2 is
specified, the setting applies to Read 1 only.
To trim multiple adapters, separate the sequences with a plus sign (+) to indicate
independent adapters that must be independently assessed for trimming for each
read.
AdapterRead2 or
TrimAdapterRead2
The adapter sequence to be trimmed in Read 2. If not provided, the sequence
specified in Adapter or TrimAdapter is applied.
To trim multiple adapters, separate the sequences with a plus sign (+) to indicate
independent adapters that must be assessed for trimming independently for each
read.
MaskAdapter
The adapter sequence to be masked rather than trimmed. If MaskAdapterRead2 is
provided, this setting masks Read 1 only.
MaskAdapterRead2
The adapter sequence to be masked in Read 2. If not provided, the same
sequence specified in MaskAdapter is applied.
FindAdaptersWithIndels
0—False. A sliding window algorithm is used and indels of adapter sequence bases
are not allowed.
1—True (default). An approximate string matching algorithm identifies the adapter,
treating indels as one mismatch.
Table 4 Adapter Trimming Specifications
Setting Description
Read1EndWithCycle The last cycle to use for Read 1.
Read2EndWithCycle
The last cycle to use for Read 2.
Read1StartFromCycle
The first cycle to use for Read 1.
Read2StartFromCycle
The first cycle to use for Read 2.
Read1UMILength
The length of the UMIused for Read 1.
Read2UMILength
The length of the UMIused for Read 2.
Read1UMIStartFromCycle
The first cycle to use for UMI in Read 1.
The cycle index is absolute and not affected by the Read1StartFromCycle setting.
The software supports UMIs only at the beginning or end of reads. Unless paired
with Read1UMILength, the software ignores this setting.
Read2UMIStartFromCycle
The first cycle to use for UMI in Read 2.
The cycle index is absolute and not affected by the Read2StartFromCycle setting.
The software supports UMIs only at the beginning or end of reads. Unless paired
with Read2UMILength, the software ignores this setting.
TrimUMI
0—False (default).
1—True. The software trims the UMI bases from Read 1 and Read 2.
ExcludeTiles
Tiles to exclude.
Separate tiles with a plus sign (+) or specify a range with a hyphen (-). For
example:ExcludeTiles,1101+2201+1301-1306 skips tiles 1101, 2201, and
1301–1306.
ExcludeTilesLaneX
Tiles to exclude for a given lane.
For example: ExcludeTilesLane6,1101–1108 skips tiles 1101–1108 for lane 6.
Table 5 Cycle, UMI, and Tile Specifications
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
10
bcl2fastq2 Conversion Software v2.20 Software Guide
Setting Description
CreateFastqForIndexReads 0—False (default).
1—True. The software generates FASTQ files for index reads.
Normally, FASTQ files for index reads are not needed because the index adapter
sequences are included in the FASTQfiles. Demultiplexing is automatic and based
on the sample sheet.*
ReverseComplement
0—False (default).
1—True. All reads are are written to FASTQ files in the reverse complement. The
reverse complements are necessary when processing mate-pair data using BWA,
which requires paired-end data, and other nonstandard cases.
Table 6 FASTQ Specifications
* FASTQfile generation is based on Index Read masks specified in the --use-bases-mask option or RunInfo.xml (when --use-bases-mask is not used).
DataSection
The software uses columns in the Data section to sort samples and index adapters.
Column Description
Lane When specified, the software generates FASTQ files only for the samples with the
specified lane number.
Sample_ID The sample ID.
Sample_Name The sample name.
Sample_Project The sample project name.
The software creates a directory with the specified sample project name and puts
the FASTQ files there. You can assign multiple samples to the same project.
index The Index 1 (i7) index adapter sequence.
index2 The Index 2 (i5)Index adapter sequence.
The Sample_Project, Sample_ID, and Sample_Name columns accept alphanumeric characters, hyphens (-),
and underscores (_). Many file systems do not support other symbols or spaces.
Do not use all or unknown as a sample ID, all or undetermined as a sample name, or all or default as the
sample project name. Samples with these terms are omitted from the report. If the Sample_ID and Sample_
Name columns do not match, the software writes the FASTQ files to the SampleIDsubdirectory.
DemultiplexingScenarios
For each sample listed in a sample sheet, the software produces one FASTQfile for each sample for each
read.
u When a sample sheet contains multiplexed samples, the software:
u Places reads without a matching index adapter sequence in the Undetermined_S0 FASTQfile.
u Places reads with valid index adapter sequences in the sample FASTQ file.
u When a sample sheet contains one unindexed sample, all reads are placed in the sample FASTQ files
(one each for Read 1 and Read 2).
u When a sample sheet does not exist, or exists but has no Data section, all reads are placed in one
FASTQfile named Undetermined_S0.
u When the Lane column in the Data section is not used, all lanes are converted. Otherwise, only
populated lanes are converted.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
11
bcl2fastq2 Conversion Software v2.20 Software Guide
Sample Sheet Creation
The Illumina Experiment Manager (IEM) software is compatible with most Illumina sequencing systems and
analysis software. Use IEMto create and edit sample sheets before starting library prep. For more
information, visit the Illumina Experiment Manager support pages on the Illumina website.
When sequencing in Manual mode on the iSeq 100 System, create a sample sheet by editing the
iSeq 100
System Sample Sheet Template for Manual Mode
. Download the template from the iSeq 100 Sequencing
System support pages.
Local Run Manager and the BaseSpace Sequence Hub Prep tab create sample sheets for you and save
them in the appropriate location. When using either of these applications, IEM and the sample sheet
template are not necessary.
Convert and Demultiplex BCLFiles
Use the following instructions to demultiplex and convert BCLfiles. Add command options to modify the
software operation as needed. If you add options that have a corresponding sample sheet setting, the
command-line value overwrites the sample sheet value.
1 Open a command-line window.
2 Type the following command and add options as needed.
nohup /usr/local/bin/bcl2fastq
For example, the following command line populates BaseCalls with FASTQ files. By default, --runfolder-
dir is the run folder and --output-dir is the BaseCalls subfolder (<run folder>\BaseCalls).
nohup /usr/local/bin/bcl2fastq --runfolder-dir <RunFolder>
--output-dir <BaseCalls>
Directory Options
Directory options determine the paths of various directories. The first two entries in the following table are
main options. The remaining entries are advanced options that provide more control of the conversion
process, but are not necessary for standard use.
Option Description Default
-R, --runfolder-dir
A main command-line option that indicates the
path to the run folder directory.
./
-o, --output-dir
A main command-line option that indicates the
path to demultiplexed output.
<runfolder-dir>/Data/Intensities/BaseCalls/
-i, --input-dir
Indicates the path to the input directory. <runfolder-dir>/Data/Intensities/BaseCalls/
--sample-sheet
Indicates the path to the sample sheet so you can
specify the sample sheet location and name, if
different from the default.
<runfolder-dir>/SampleSheet.csv
--intensities-dir
Indicates the path to the intensities directory.
When the intensities directory is specified, the
input directory must also be specified.
<input-dir>/../
--interop-dir
Indicates the path to the demultiplexing statistics
directory.
<runfolder-dir>/InterOp/
--stats-dir
Indicates the path to the demultiplexing statistics
directory (human-readable).
<output-dir>/Stats/
--reports-dir
Indicates the path to the reporting directory. <output-dir>/Reports/
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
12
bcl2fastq2 Conversion Software v2.20 Software Guide
Processing Options
Processing options control threading. For example, you want to limit your usage because you share
computing resources.
Option Description Default
-r, --loading-threads
Number of threads to load BCL data. Depends on system
architecture.
-p,
--processing-threads
Number of threads to process demultiplexing data. Depends on system
architecture.
-w,
--writing-threads
Number of threads to write FASTQ data. This number must
be lower than number of samples.
Depends on system
architecture.
When threading is supported, the software uses the follow defaults to manage threads for processing:
u Four threads for reading the data.
u Four threads for writing the data.
u Twenty percent of threads for demultiplexing data.
u One hundred percent of threads for processing demultiplexed data.
The file i/o threads are typically inactive and consume minimal processing time. Processing demultiplexed
data is allocated one thread per central processing unit (CPU) to prevent idle CPUs, resulting in more threads
than CPUs by default.
Considerations for Multiple Threads
When using processing options to assign multiple threads, consider the following information:
u The most demanding step is the processing step (-p option). Assign this step the most threads.
u The reading and writing stages are simple and do not need many threads. This consideration is important
for a local hard drive. Too many threads cause too many parallel read-write actions and suboptimal
performance.
u Use one thread per CPU core plus some extra. This method prevents CPUs from being idle due to a
thread being blocked while waiting for another thread.
u The number of threads depends on the data. If you specify more writing threads than samples, the extra
threads do no work but cost time due to context switching.
Behavioral Options
Behavioral options determine how the software responds to file compression, tile and cycle processing,
missing or corrupt files, masking, and trimming. Masking replaces values with N instead of removing them as
trimming does.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
13
bcl2fastq2 Conversion Software v2.20 Software Guide
Option Description Default
--adapter-stringency
The minimum match rate that triggers masking or trimming. This
value is calculated as MatchCount / (MatchCount +
MismatchCount).
Accepted values are 0–1. However, using any value <0.5
introduces too many false positives and is not recommended. The
default value of 0.9 indicates that only reads with >90% sequence
identity with the adapter are trimmed.
0.9
--barcode-mismatches
The number of mismatches allowed per index adapter. Accepted
values are 0, 1, or 2.
Multiple, comma-delimited entries are allowed. Each entry is applied
to the corresponding index adapter. The last entry applies to all
remaining index adapters.
1
--create-fastq-for-index-reads
Create FASTQ files for index reads based on the following
guidelines:
• The --use-bases-mask option specifies index read masks.
• When --use-bases-mask is not used, use RunInfo.xml.
N/A*
--ignore-missing-bcls
The software ignores missing or corrupt BCL files and assumes
'N'/'#' for missing calls.
N/A*
--ignore-missing-filter
The software ignores missing or corrupt filter files and assumes that
all clusters in tiles with missing filter files passed filter.
N/A*
--ignore-missing-positions
The software ignores missing or corrupt cluster location files. When
cluster location files are missing, the software writes unique
coordinate positions into the FASTQ header.
N/A*
--minimum-trimmed-read-length
The minimum read length after adapter trimming.
The software trims adapter sequences from reads to the value of
this parameter. Bases below the specified value are masked.
35
--mask-short-adapter-reads
Specifies the following behavior:
• If the number of bases remaining after adapter trimming is less
than --minimum-trimmed-read-length, force the read length to be
equal to --minimum-trimmed-read-length. Mask adapter bases
below this length.
• If the remaining number of bases is below --mask-short-adapter-
reads, mask all bases to result in a read masked per --minimum-
trimmed-read-length.
• Reads shorter than the setting for --mask-short-adapter-reads are
also masked.
Specify a value that is less than or equal to --minimum-trimmed-
read-length, otherwise this option does not apply. A greater value
automatically defaults to the same value as --minimum-trimmed-
read-length.
Applying this option does not require trimming the read.Rather, it
must be below the --minimum-trimmed-read-length.
22
--tiles
Selects a subset of available tiles for processing. To make multiple
selections, separate the regular expressions with commas.
For example:
• To select all tiles ending with 5 in all lanes:
--tiles [0–9][0–9][0–9]5
• To select tile 2 in lane 1 and all the tiles in the other lanes:
--tiles s_1_0002,s_[2-8]
N/A*
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
14
bcl2fastq2 Conversion Software v2.20 Software Guide
Option Description Default
--use-bases-mask
Specifies how to process each cycle:
• n—Ignore the cycle.
• Y (or y)—Use the cycle.
• I—Use the cycle for an Index Read.
• A number—Repeat the previous character the indicated number
of times.
• *—Repeat the previous character until the end of the read or index
(length per RunInfo.xml).
Commas separate read masks. The format for dual indexing is the
following syntax or specified variations:
--use-bases-mask Y*,I*,I*,Y*
You can also specify --use-bases-mask multiple times for separate
lanes. In the following example,1:indicates that the setting applies
to lane 1. The second --use-bases-mask parameter applies to all
other lanes.
--use-bases-mask 1:y*,i*,i*,y* --use-bases-mask
y*,n*,n*,y*
If this option is not specified, RunInfo.xml determines the mask. If it
cannot determine the mask, specify the --use-bases-mask option.
When specified, the number of index cycles and the index length in
the sample sheet must match.
N/A*
--with-failed-reads
Include all clusters in the output, including those that did not pass
filter. By default, clusters that did not pass filter are excluded.
FASTQ files containing failed reads cannot be uploaded to
BaseSpace Sequence Hub.
After cycle 25, RTA2 stops reading clusters that do not pass filter.
Systems other than MiSeq and HiSeq 2500 produce 25 bases, then
all Ns.
This option cannot be applied to CBCLfiles.
N/A*
--write-fastq-reverse-complement
Generate FASTQ files with the reverse complements of actual data. N/A*
--no-bgzf-compression
Turn off BGZF and use GZIP to compress FASTQ files.
BGZF compression allows downstream applications to decompress
in parallel. This option is available for FASTQ data consumers that
cannot handle standard GZIP formats.
N/A*
--fastq-compression-level
The Zlib compression level (1–9) to apply to FASTQ files. 4
--no-lane-splitting
Do not split FASTQ files by lane.
If you plan to upload the FASTQ files to BaseSpace Sequence Hub,
do not use
this option. It generates FASTQ files that are not
compatible with the file uploader.
N/A*
--find-adapters-with-sliding-window
Finds adapters using a simple sliding window algorithm. Ignores
adapter sequence indels.
N/A*
* Not applicable
General Options
General options determine miscellaneous settings for help, version information, and the minimum log level.
Option Description Default
-h,
--help
Produce a help message and exit the application. Not applicable
-v,
--version
Print version information. Not applicable
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
15
bcl2fastq2 Conversion Software v2.20 Software Guide
Option Description Default
-l,
--min-log-level
The minimum log level, prioritizes messages. Acceptable values are
NONE, FATAL, ERROR, WARNING, INFO, DEBUG, and TRACE.
INFO
Output Files and Directory
The bcl2fastq2 Conversion Software v2.20 generates the following files as output:
u FASTQfiles
u InterOp files
u ConversionStats file
u DemultiplexingStats file
u Adapter Trimming file
u FastqSummary and DemuxSummary
u HTML reports
u JavaScript Object Notation (JSON) file
FASTQ Files
As converted versions of BCLfiles, FASTQfiles are the primary output of the bcl2fastq2 Conversion Software.
Like BCLfiles, FASTQfiles contain base calls with associated Q-scores. Unlike BCLfiles, which contain
per-cycle data, FASTQ files contain the per-read data that most analysis applications require.
The software generates one FASTQ file for every sample and every read. For example, for each sample in a
paired-end run, the software generates two FASTQ files: one for Read 1 and one for Read 2. In addition to
these sample FASTQ files, the software generates one FASTQ file containing all unknown samples. FASTQ
files for Index Read 1 and Index Read 2 are typically not necessary, but are generated when the option
--create-fastq-for-index-reads is applied.
FASTQ Files Directory
The software writes compressed, demultiplexed FASTQ files to the directory <run folder>\Data\Intensities\
BaseCalls.
u If a sample sheet specifies the Sample_Project column for a sample, the software places the FASTQ files
for that sample in the directory <run folder>\Data\Intensities\BaseCalls\<Project>. The same project
directory contains the files for multiple samples.
u If the Sample_ID and Sample_Name columns are specified but do not match, the FASTQ files reside in a
<SampleID> subdirectory where files use the Sample_Name value.
Reads with unidentified index adapters are recorded in one file named Undetermined_S0_. If a sample sheet
includes multiple samples without specified index adapters, the software displays a missing barcode error
and ends the analysis.
NOTE
The software allows one unindexed sample because identification is not necessary to sequence one sample.
However, sequencing multiple samples requires multiplexing so the samples can be identified for analysis.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
16
bcl2fastq2 Conversion Software v2.20 Software Guide
File Names
FASTQ files are named with the sample name and number, the flow cell lane, and read. The file extension is
*.fastq.gz. For example: samplename_S1_L001_R1_001.fastq.gz.
u samplename—The name of the sample provided in the sample sheet. If a sample name is not available,
the file name uses the sample ID instead.
u S1—The number of the sample based on the order that samples are listed in the sample sheet, starting
with 1. In the example, S1 indicates that the sample is the first sample listed for the run.
NOTE
Reads that cannot be assigned to any sample are written to a FASTQ file as sample number 0 and
excluded from downstream analysis.
u L001—The lane number of the flow cell, starting with lane 1, to the number of lanes supported.
u R1—The read. In the example, R1 indicates Read 1. R2 indicates Read 2 of a paired-end run.
u 001—The last portion of the file name is always 001.
File Format
FASTQ files are text-based files that contain base calls with corresponding Q-scores for each read. Each file
has one 4-line entry:
u A sequence identifier with information about the run and cluster, formatted as:
@Instrument:RunID:FlowCellID:Lane:Tile:X:Y:UMI Read:Filter:0:IndexSequence
or SampleNumber
u The sequence (base calls A, G, C, T, and N, for unknown bases).
u A plus sign (+) that functions as a separator.
u The Q-score using ASCII 33 encoding (see
Quality Score Encoding
).
Field Description
@
Each sequence identifier line starts with @.
instrument
The instrument ID.
run ID
The run number on the system.
flow cell ID
The flow cell ID.
lane
The flow cell lane number.
tile
The flow cell tile number.
x_pos
The X coordinate of the cluster.
y_pos
The Y coordinate of the cluster.
UMI
[Optional] The UMI sequence (A, G, C, T, and N). When the sample sheet specifies
UMIs, a plus sign separates the Read 1 and Read 2 sequences.
read
1—Read 1, which is the first read of a paired-end run or the only read of a single-
read run.
2—Read 2, which is the second read of a paired-end run.
is filtered
Y—The read is filtered (shows when the --with-failed-reads option is applied).
N—The read is not filtered.
Table 7 Sequence Identifier Fields
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
17
bcl2fastq2 Conversion Software v2.20 Software Guide
Field Description
control number
0—Control bits are not turned on.*
index sequence or sample
number
The Index Read sequence (A, G, C, T, and N).
• If the sample sheet indicates indexing, the index adapter sequence is appended
to the end of the read identifier.
• If indexing is not indicated (one sample per lane), the sample number is
appended to the read identifier.
*Since the deprecation of control files starting with bcl2fastq2 Conversion Software v2.19, the control number value is always 0.
A complete FASTQfile entry resembles the following example:
@SIM:1:FCX:1:2106:15337:1063:GATCTGTACGTC 1:N:0:ATCACG
GATCTGTACGTCTCTGCNTCACCTCCACCGTGCAACTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTA
+
CCCCCGGGGGGGGGGGG#:CFFGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGFGGG
File Compression
FASTQ files are compressed in the GNU zip format and appended with *.gz to create the extension
*.fastq.gz. You can use tools such as gzip (command line) or 7-zip (GUI) to decompress FASTQfiles.
NOTE
FASTQ files are too large to open in a standard text editor, and viewing them is not necessary. If you must
view FASTQfiles for troubleshooting purposes: use a text editor that can handle large files or a Unix or Linux
operating system that can view large files via the command line.
The BGZF compression variant facilitates parallel decompression of FASTQ files by downstream applications.
If a downstream application cannot handle the BGZF variant, use the --no-bgzf-compression option to turn it
off. See
Behavioral Options
on page 13.
Quality Scores
A quality score, or Q-score, is a prediction of the probability of an incorrect base call. A higher Q-score
implies that a base call is higher quality and more likely to be correct.
Based on the Phred scale, the Q-score is a compact way to communicate small error probabilities. Given a
base call, X, the probability that X is not true, P(~X), results in a quality score, Q(X). The following calculation
shows this relationship, where P(~X) is the estimated error probability:
Q(X) = -10 log
10
(P(~X))
The following table shows the relationship between the quality score and error probability.
Q-score Q(X) Error Probability P(~X)
Q40 0.0001 (1 in 10,000)
Q30 0.001 (1 in 1,000)
Q20 0.01 (1 in 100)
Q10 0.1 (1 in 10)
During a run, base call quality scores are calculated after cycle 25. The results are recorded in BCL files with
the base call for the cycle.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
18
bcl2fastq2 Conversion Software v2.20 Software Guide
Quality Score Encoding
In FASTQ files, Q-scores are encoded into a compact form that uses only 1 byte per quality value. This
encoding represents the quality score as the character with an ASCII code equal to the value + 33.
The following table demonstrates the relationship between the encoding character, ASCII code, and
represented Q-score. When Q-score binning is used, the subset of Q-scores applied by the bins is
displayed.
Symbol ASCIICode Q-score
! 33 0
" 34 1
# 35 2
$ 36 3
% 37 4
& 38 5
' 39 6
( 40 7
) 41 8
* 42 9
+ 43 10
, 44 11
- 45 12
. 46 13
/ 47 14
0 48 15
1 49 16
2 50 17
3 51 18
4 52 19
5 53 20
6 54 21
7 55 22
8 56 23
9 57 24
: 58 25
; 59 26
< 60 27
= 61 28
> 62 29
? 63 30
@ 64 31
Table 8 ASCII Characters Encoding Q-Scores 0–40
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
19
bcl2fastq2 Conversion Software v2.20 Software Guide
Symbol ASCIICode Q-score
A 65 32
B 66 33
C 67 34
D 68 35
E 69 36
F 70 37
G 71 38
H 72 39
I 73 40
InterOp Files
InterOp files reside in the InterOp folder of the run directory. The Sequencing Analysis Viewer (SAV) software
uses InterOp files as input to summarize run metrics, such as cluster density, intensities, and Q-scores.
The IndexMetricsOut.bin file generated by bcl2fastq2 Conversion Software stores index metrics and has the
following binary format:
Byte 0: file version (1)
Bytes (variable length): record:
u 2 bytes: lane number (unint16)
u 2 bytes: tile number (unint16)
u 2 bytes: read number (unint16)
u 2 bytes: number of bytes Y for index name (unint16)
u Y bytes: index name string (string in UTF8Encoding)
u 4 bytes: # clusters identified as index (uint32)
u 2 bytes: number of bytes V for sample name (unint16)
u V bytes: sample name string (string in UTF8Encoding)
u 2 bytes: number of bytes W for sample project (unint16)
u W bytes: sample project string (string in UTF8Encoding)
ConversionStats File
The ConversionStats.xml file resides in the Stats folder of the output directory or in the directory specified by
the --stats-dir option. The file contains the lane number for each lane and the following information for each
tile:
u Raw Cluster Count
u Read Number
u YieldQ30
u Yield
u QualityScore Sum
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
20
bcl2fastq2 Conversion Software v2.20 Software Guide
DemultiplexingStats File
The DemultiplexingStats.xml file resides in Stats folder of the output directory or in the directory specified by
the --stats-dir option.
The file contains the flow cell ID and project name. For each sample, index, and lane, the file lists the
BarcodeCount, PerfectBarcodeCount, and OneMismatchBarcodeCount (if applicable).
Adapter Trimming File
The adapter trimming file is a text-based file that contains a statistics summary of adapter trimming for a
FASTQ file. The file resides in the Stats folder of the output directory or in the directory specified by the --
stats-dir option.
The file contains the fraction of reads with untrimmed bases for each sample, lane, and read number plus the
following information:
u Lane
u Read
u Project
u Sample ID
u Sample Name
u Sample Number
u TrimmedBases
u PercentageOfBases (being trimmed)
FastqSummaryF1L# File
A FastqSummaryF1L#.txt file contains the number of raw and passed filter reads for each sample and tile in a
lane. The number sign (#)indicates the lane number.
The files reside in the Stats folder of the output directory or in the directory specified by the --stats-dir option.
DemuxSummaryF1L# File
DemuxSummaryF1L#.txt files, where # indicates the lane number, are generated when the sample sheet
contains at least one indexed sample. A file contains the percentage of each tile that each sample occupies.
It also lists the 1000 most common unknown index adapter sequences and the total number of reads with
each index adapter identified.
NOTE
To improve processing speed, the total for each index adapter is based on an estimate from a sampling
algorithm.
These files are located in the Stats folder of the output directory or in the directory specified by the --stats-dir
option.
HTML Reports
HTML reports are generated from data in DemultiplexingStats.xml and ConversionStats.xml. The reports
reside in Reports\html in the output directory or in the directory specified by the --reports-dir option.
The flow cell summary contains the following information:
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
21
bcl2fastq2 Conversion Software v2.20 Software Guide
u Clusters (Raw)
u Clusters (PF)
u Yield (MBases)
NOTE
For patterned flow cells, the number of raw clusters is equal to the number of wells on the flow cell.
The lane summary provides the following information for each project, sample, and index sequence specified
in the sample sheet:
u Lane #
u Clusters (Raw)
u % of the Lane
u % Perfect Barcode
u % One Mismatch
u Clusters (Filtered)
u Yield
u % PF Clusters
u %Q30 Bases
u Mean Quality Score
The Top Unknown Barcodes table in the HTML report provides the count and sequence for the 10 most
common unmapped index adapters in each lane.
Java Script Object Notation File
The JavaScript Object Notation (JSON)file facilitates parsing the output data. The data in the JSONfile are a
combination of the following files:
u InterOP
u ConversionStats
u DemultiplexingStats
u Adapter trimming
u FastqSummary and DemuxSummary
u HTMLreport
u The JSONfile format is similar to the following example:
{
Flowcell: string //matches Flowcell from RunInfo.xml
RunNumber: int, //matches Run Number from RunInfo.xml
RunId: string, //matches Run Id from RunInfo.xml
ReadInfosForLanes: [ //details per-lane read information
{
LaneNumber: int,
ReadInfos: [
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
22
bcl2fastq2 Conversion Software v2.20 Software Guide
Number: int, //indicates read 1 or read 2 (possible values: 1
and 2)
NumCycles: int, //indicates number of cycles for this read
IsIndexedRead, bool // indicates whether or not this read is an
index read
]
}
],
ConversionResults:[ //details the conversion/demultiplexing results
{
LaneNumber: int,
TotalClustersRaw: int, //number of raw clusters in this lane
(null for HiSeq X)
TotalClustersPf: int //number of clusters passing filter in this
lane
Yield: int, //total yield in this lane
DemuxResults: [ //do not include undetermined reads in this
array
{
SampleId: string,
SampleName: string,
IndexMetrics: [ //empty array if no indices were used for
demultiplexing this sample
{
IndexSequence: string, //if there are two indices,
then concatenate with '+' character (e.g.
"ATCGTCG+TGATCTA")
MismatchCounts: {
0: int, //count of perfectly matching barcodes
1: int //count of barcodes with one mismatch
}
}
],
NumberReads: int, //number of read pairs identified as
index/index-pair
Yield: int, //number of bases after trimming
ReadMetrics: [
{
ReadNumber: int,
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
23
bcl2fastq2 Conversion Software v2.20 Software Guide
Yield: int,
YieldQ30: int,
QualityScoreSum: int,
TrimmedBases: int
}
]
}
]
}
],
UnknownBarcodes: [ //details all the unknown barcodes for a given lane
and number of times it was encountered
{
Lane: int,
Barcodes: {
string: int //example: "ATGAAGAT": 5888
}
}
]
}
Troubleshooting
u If the software fails to complete an analysis, review the log file for missing input files or corrupt files. The
reported file status varies depending on the type of file corruption. If a BCLfile is the problem, apply the
--ignore-missing-bcls command. See
Behavioral Options
on page 13.
u If the software cannot process TruSeq Small RNAsamples, apply the --minimum-trim-read-length 20 and
--mask-short-adapter-reads 20 options to overwrite the default values. See
Behavioral Options
on page
13.
u If the software assigns a high percentage of reads as undetermined, review the Top Unknown Barcodes
table in the HTMLreport.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
24
bcl2fastq2 Conversion Software v2.20 Software Guide
Revision History
Document Date Description of Change
Document # 15051736 v03 February
2019
Updated software descriptions to bcl2fastq2 Conversion Software v2.20, which
supports the iSeq 100 System.
Updated the name of BaseSpace to BaseSpace Sequence Hub.
Updated file format descriptions for consistency.
Updated installation information:
• Added descriptions of both installation options.
• Indicated that installing the software requires assistance from a system
administrator or ITrepresentative.
Added information on:
• Viewing FASTQ files.
• Sample sheets for Local Run Manager and the BaseSpace Sequence Hub
Prep tab.
• The difference between the term output folder and run folder.
Renamed this guide to
bcl2fastq2 Conversion Software v2.20 Software Guide
.
Renamed and combined some sections to improve continuity.
Referenced the
Index Adapters Pooling Guide (document # 1000000041074)
for information on multiplexing.
Removed diagrams of input file directories, which are available in the system
guides.
Removed the even number option from the description of the control number
field.
Clarified the following points:
• Illumina Experiment Manager (IEM)produces sample sheets, but does not
convert or demultiplex files.
• The bcl2fastq2 Conversion Software generates one FASTQ file for each
sample for each read, plus one file for all unassigned samples in a read.
• Only one unindexed sample is permitted in a sample sheet.
• Nand X each indicate an unknown base.
• Position files are cluster location files.
Redirected the software downloads link to the bcl2fastq Conversion Software
support pages.
Corrected the definition of JSONto JavaScript Object Notation.
Corrected descriptions of read field entries and DemultiplexingStats.xml
contents.
Corrected information on the run folder naming convention.
Document # 15051736 v02 March
2018
Updated software descriptions to bcl2fastq2 Conversion Software v2.19.
Updated the BCL2FASTQ options.
Added the NovaSeq 6000 System file structure.
Added information on the CBCL file format.
Document # 15051736 v01 April
2016
Updated to support bcl2fastq2 v2.18.
Updated BCL2FASTQ options and sample sheet settings.
Added JSON file and input files list for the MiniSeq System.
Document # 15051736
Rev. G
July
2015
Updated to software requirements, gcc version.
Document # 15051736
Rev. F*
June
2015
Updated to support bcl2fastq2 v2.17.
* Dates and change descriptions for revisions A–E are not available.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
25
bcl2fastq2 Conversion Software v2.20 Software Guide
Technical Assistance
For technical assistance, contact Illumina Technical Support.
Website:
www.illumina.com
Email:
techsupport@illumina.com
Illumina Customer Support Telephone Numbers
Region Toll Free Regional
North America
+1.800.809.4566
Australia
+1.800.775.688
Austria
+43 800006249 +43 19286540
Belgium
+32 80077160 +32 34002973
China
400.066.5835
Denmark
+45 80820183 +45 89871156
Finland
+358 800918363 +358 974790110
France
+33 805102193 +33 170770446
Germany
+49 8001014940 +49 8938035677
Hong Kong
800960230
Ireland
+353 1800936608 +353016950506
Italy
+39 800985513 +39 236003759
Japan
0800.111.5011
Korea
+82 80 234 5300
Netherlands
+31 8000222493 +31 207132960
New Zealand
0800.451.650
Norway
+47 800 16836 +47 21939693
Singapore
+1.800.579.2745
Spain
+34 911899417 +34 800300143
Sweden
+46 850619671 +46 200883979
Switzerland
+41 565800000 +41 800200442
Taiwan
00806651752
United Kingdom
+44 8000126019 +44 2073057197
Other countries
+44.1799.534000
Safety data sheets (SDSs)—Available on the Illumina website at support.illumina.com/sds.html.
Product documentation—Available for download in PDF from the Illumina website. Go to
support.illumina.com, select a product, then select Documentation & Literature.
Document # 15051736 v03
For Research Use Only. Not for use in diagnostic procedures.
26
bcl2fastq2 Conversion Software v2.20 Software Guide
Illumina
5200 Illumina Way
San Diego, California 92122 U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
techsupport@illumina.com
www.illumina.com
For Research Use Only. Not for use in diagnostic procedures.
© 2019 Illumina, Inc. All rights reserved.
Document # 15051736 v03